当前位置: 首页 > >

Evaluation of endogenous reference genes for analysis of gene

发布时间:

Mol Biol Rep DOI 10.1007/s11033-010-0570-8

Evaluation of endogenous reference genes for analysis of gene expression with real-time RT-PCR during planarian regeneration
Yan-qing Yuwen ? Zi-mei Dong ? Qing-hua Wang ? Xiao-juan Sun ? Chang-ying Shi ? Guang-wen Chen

Received: 10 January 2010 / Accepted: 19 November 2010 ? Springer Science+Business Media B.V. 2010

Abstract It is important that endogenous reference genes for real-time RT-PCR be empirically evaluated for stability in different cell types, developmental stages, and/or sample treatment. To select the most stable endogenous reference genes during planarian regeneration, three housekeeping genes, 18S rRNA, ACTB and DjEF2, were identi?ed and established expression levels by real-time RT-PCR. The data were analyzed by GeNorm and NormFinder software. Expression levels of the Djsix-1 gene were studied in parallel with ACTB and DjEF2 both or each and 18S rRNA as reference during regeneration. The results showed that ACTB was the most stable expressed reference gene in the planarian regeneration. Keywords RT-PCR ? SYBR ? Endogenous reference genes ? Planarian ? Djsix-1

Introduction Comparative gene expression studies in different regenerating periods of planarian provide insights into molecular mechanisms of regenerations. Quantitative real-time reverse transcription PCR (qRT-PCR) is an extremely sensitive technique that allows the precise measurement of gene expression across more than seven orders of

Z. Dong contributed equally to this work. Y. Yuwen ? Z. Dong ? Q. Wang ? X. Sun ? C. Shi ? G. Chen (&) Henan Normal University, Xinxiang 453007, People’s Republic of China e-mail: chengw0183@sina.com

magnitude [1]. Along the process, several controls are needed to ensure the integrity of each step and therefore, to obtain reliable and accurate results [2, 3]. This process includes RNA extraction (yield, integrity, and DNA contamination), ef?ciency of the reverse transcription and PCR steps, amount of RNA added into the reaction, etc. [4]. To cover all of these variables, a reference gene is commonly used in the relative quanti?cation and is selected on its supposedly equal expression in each cell of a speci?c tissue and under different treatments and designs. Nevertheless, the expression level of many commonly used endogenous controls frequently vary across tissue type or experimental conditions [5]. One software, called ‘‘GeNorm’’, is designed determine the most stable housekeeping gene via a stepwise exclusion or ranking process resulting in the selection of the most stable reference genes for the speci?c tissue and this approach has already been successfully used to determine a panel of recommended housekeeping genes for gene expression studies [6–11]. Several housekeeping genes are commonly used as reference genes for qRT-PCR, such as elongation factor-1 (EF1), elongation factor-2 (EF2), 18 s ribosomal RNA (18S rRNA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein L37 (L37), a-tubulin (Tub) and b-actin (ACTB), but some of them have been reported varying sometimes [12–15]. Planarian ?atworms belong to the free-living members of Platyhelminthes. Planarians can regenerate their entire body plan from small pieces after cutting or injuring. This remarkable morphological plasticity has made them an excellent model for the investigation of regeneration and stem cell biology in the past decade [16]. With the application of a variety of biological techniques and development of genomic reagents, the molecular mechanisms of regeneration have been explored to analyze phenomena

123

Mol Biol Rep

such as morphogenesis, restoration of pattern and polarity [17], control of tissue proportions and tissue homeostasis. Djsix-1 are expressed in both regenerating eyes and in differentiated photoreceptors of intact adults by wholemount in situ hybridization and through RNAi studies showed that they are essential for maintenance of the differentiated state of photoreceptor cells [18, 19]. In this study, the expression pattern of Djsix-1 gene was investigated in parallel, and three well-known reference genes ACTB, 18S rRNA and DjEF2 (EF2 of Dugesia japonica) were evaluated with the GeNorm and NormFinder software to ?nd which was the best endogenous reference genes for SYBR green qRT-PCR studies in planarian regeneration.

genomic DNA, total RNA was treated with DNase I (Invitrogen) for 30 min, followed by spin-column puri?cation. The quality was determined by gel electrophoresis and the quanti?cation was performed spectrophotometrically (data not shown). First-strand cDNA synthesis was reverse transcribed at 42°C using SYBR? PrimeScriptTM RT-PCR Kit (TaKaRa, Dalian, China) with 2 ll total RNA (about 500 ng), 1 ll Oligo (dT) primer (50 lM) and 1 ll Random 6 mers (100 lM) in a 20 ll reaction volume. Lack of genomic DNA contamination was con?rmed by PCR ampli?cation of RNA samples in the absence of cDNA synthesis. Primer design

Materials and methods Animals and sample preparation Planarians used in this work were collected in Tagang water reservoir of Henan province, China. Animals were cultured in autoclaved stream water at 18°C and starved for 1 or 2 weeks before being used in the experiments. Twenty planarians were transected at the pre-pharyngeal level and the tail fragments were cultured in the same plate with autoclaved stream water at 18°C, which were marked zero day. Then ?ve cultured fragments were randomly selected at the 3, 6 and 7 day, respectively, and their pre-pharyngeal regenerated fragments were cut for preparation of total RNA. RNA isolation and cDNA synthesis For each treatment, ?ve pre-pharyngeal regenerated pieces as one sample were taken immediately after the start of treatment and snap-frozen in liquid nitrogen. Then Total RNA from the sample was extracted using the TRIzol reagent (TaKaRa, Dalian, China) according to manufacturer’s instruction. In order to avoid ampli?cation of

The primers for 18S rRNA (DQ666002), ACTB (AB292462), and Djsix-1 (AJ557022) were designed using Primer Premier 5.0 software (PREMIER Biosoft Int., Palo Alto, CA) under default parameters according to the published sequences on GenBank. The primers for DjEF2 were taken from published paper [20]. The primer sequences were given in Table 1. BLAST searches were performed to con?rm the total gene speci?city of the primer sequences, and the results showed the absence of multi-locus matching at the primer site. Quantitative PCR with SYBR green The mRNA expression of ACTB, DjEF2, 18S rRNA and Djsix-1 genes in the regenerated fragments, collected at different time points after transsection (0, 3, 5 and 7 day), were measured by quantitative PCR assay using SYBR? Green I dye. The quantitative PCR mixture contained 2 ll of diluted cDNA, 10 ll of 29 SYBR? Premix Ex TaqTM (TaKaRa, Dalian of China), 0.4 ll of each gene-speci?c primer, and 0.4 ll ROX Reference Dye II (509 )in a ?nal volume of 20 ll. The real-time PCRs were performed employing ABI Prism 7,500 Sequence Detection System and software (PE, Applied Biosystems, USA). All realtime PCRs were performed under following conditions:

Table 1 Endogenous reference genes and their primer sequences used for real-time PCR analysis Gene name 18S rRNA ACTB DjEF2 Djsix-1 Accession no. DQ666002 AB292462 Unpublished AJ557022 Primer sequence (50 –30 ) AACGGCTACCACATCC (F) ACCAGACTTGCCCTCC (R) ACACCGTACCAATCTATG (F) GTGAAACTGTAACCTCGT (R) TTAATGATGGGAAGATATGTTG (F) GTACCATAGGATCTGATTTTGC (R) CCGAGAACAATATGGGATGGT (F) TTCTTTTCTCTTGGGGATGGAT (R) F forward primer, R reverse primer 60 113 1.96 63 Unknown 162 About 250 2.03 1.97 Tm (°C) 59 Product size (bp) 121 PCR ef?ciency 1.98

123

Mol Biol Rep

30 s at 95°C, and 40 cycles of 5 s at 95°C and 34 s at 60°C in a 96 well plate (Applied Biosystems, USA). The speci?city of ampli?cation was veri?ed by melting curve analysis (95°C/15 s, 60°C/1 min, 95°C/15 s and 60°C/15 s) after 40 cycles. All samples were ampli?ed in three replicates and the mean was used for real-time PCR analysis. In order to determine the PCR ef?ciency, a 10-fold dilution series of cDNA (1:10–1:10,000) was made and 1 ll of the diluted cDNA was used per reaction. The reaction mixture and the thermal pro?le of the real-time PCR were the same as described above. Djsix-1 gene expression data were analyzed according to GeNorm manual as shown the mean ± SD of three determinations of each sample. Analysis of expression stability To analyze the gene expression stability, the Ct value for all three reference genes were evaluated using the M value of GeNorm (version 3.4) and the stability value of NormFinder (version 0.953). The data sets are entered as log-transformed data according to the instruction manuals for user.

30 25 20

Ct value

15 10 5 0 18s RNA ACTB DjEF2

0

3

5

7

Regeneration days

Fig. 1 RNA transcription levels of the three tested endogenous control genes at different regeneration day of planarian presented as the Ct mean value

Average expression stability values of remaining control genes Average expression stability M
1.25 1.2 1.15 1.1 1.05 1 0.95 0.9 18S actin EF2

Results Expression levels of ACTB, DjEF2, and 18S rRNA in different times of planarian regeneration The transcriptional stability of three commonly used reference genes was examined using absolute Ct values. All three reference genes showed moderately to high expression with a mean overall Ct values below 30 for each gene. ACTB was the moderate abundant reference gene (Ct = 17.81) throughout the time course with the least overall variability (SD = 1.582, CV = 0.089) making it a good reference gene while measuring the expression of genes with high or low abundance. The remaining two reference genes, DjEF2 and 18S rRNA had somewhat higher variation when compared to the overall variation seen with ACTB (Fig. 1). ACTB and 18S rRNA had higher expression level with the low Ct value than DjEF2 with the high Ct value, but ACTB and DjEF2 had similar expression tendency and 18S rRNA had signi?cant change at the 3, 5 day (Fig. 1). Determining the transcriptional stability of reference genes in planarian using the programs GeNorm and NormFinder The expression stability of the three endogenous reference genes was analyzed and ranked accordingly with two

<::::: Least stable genes

Most stable genes ::::>

Fig. 2 Average expression stability values of control genes by GeNorm analysis. The M value was de?ned to measure gene expression stability. The higher the M value, the lower the stability. The least stable gene is displayed on the left, and the most stable genes on the right

reference gene identi?cation programs, GeNorm and NormFinder. These programs have been used in a wide array of gene expression studies involving real-time RT-PCR. The GeNorm is a statistical algorithm which determines the gene stability measure (M) of all the genes under investigation, based on the geometric averaging of multiple reference genes and mean pairwise variation of a gene from all other reference genes in a given set of samples [21]. It relies on the principle that the expression ratio of two ideal endogenous reference genes is identical in all the samples, regardless of the experimental condition and cell-type. Genes with the lowest M values have the most stable expression. NormFinder ranks a set of endogenous genes according to their expression stability in given sample set and given experimental design [22]. Using the GeNorm program, ACTB and DjEF2 with the low M value were the most stable genes, while 18S rRNA

123

Mol Biol Rep Table 2 Stability value of ACBT, DjEF2 and 18S RNA by NormFinder program Gene name 18S rRNA ACTB DjEF2 Stability value 0.072 0.021 0.057

Discussion Real-time PCR now is widely used in gene expression analysis. To get reliable results from real-time PCR analysis, however, it is important to select a stable endogenous reference gene. The ideal endogenous reference genes should have similar expression regardless of experimental conditions, including different cell types, developmental stages, and/or sample treatment [23]. In real-time PCR experiments, the housekeeping genes (HKGs) often are selected as the endogenous genes, but numerous studies reported that expression of housekeeping genes can also vary considerably with experimental conditions [24–26]. Therefore, it is necessary to validate the expression stability of an endogenous gene under speci?c experimental conditions prior to its use for normalization. In our experiment, three common endogenous genes, 18S rRNA, ACTB and DjEF2, were selected and analyzed their stability during the planarian regeneration with the GeNorm and NormFinder software, which are widely used to assess and select the suitable endogenous genes in realtime PCR. In the past DjEF2 has been used as an endogenous reference gene [20], but it remained unclear whether this gene is the best possible choices for normalizing gene expression data in planarian. The data presented here
1.20

had the lowest expression stabilities during regeneration (Fig. 2). Results of NormFinder analysis for the three reference genes were shown in Table 2. The results showed that ACTB was the most stable gene (stability value 0.021). Djsix-1 expression during regeneration The expression level of Djsix-1 gene was the highest at zero day using any gene as the reference gene, it was the lowest at 3 days of regeneration and then raised gradually using ACTB and DjEF2 both or each, and compared with ACTB and DjEF2 both (Fig. 3a) or each (Fig. 3c, d), using 18S rRNA alone as the unique internal control, the expression level of Djsix-1 gene was the lowest at 5 days of regeneration and the expression level at 7 days was higher that that at 5 days (Fig. 3b).
Fig. 3 The Djsix-1 expression pattern using a ACTB and DjEF2 in combination, b 18S rRNA alone as reference gene, c DjEF2 alone as reference gene and d ACTB alone as reference gene. Analysis with GeNorm and NormFinder showed that ACTB and DjEF2 was the most reference gene

a
2.50

b
Normalized fold expression

Normalized fold expression

2.00 1.50 1.00 0.50 0.00

0.80

0.40

0

3

5

7

0.00

0

3

5

7

Days of regeneration

Days of regeneration

c
Normalized fold expression

4.50 4.00 3.50 3.00 2.50 2.00 1.50 1.00 0.50 0.00 0 3 5 7

d
Normalized fold expression

1.60

1.20

0.80

0.40

0.00

0

3

5

7

Days of regeneration

Days of regeneration

123

Mol Biol Rep

describe the validation of these three genes in different regeneration stages of planarian. The results all show, that these three reference genes were stably expressed, whereas ACTB exhibited most stable expression in different regeneration stage, followed by DjEF2 and 18S rRNA no matter GeNorm or NormFinder was used. It is generally recognized that 18S rRNA cannot be used as a reference gene where RT reaction is carried out using an oligo-dT primer or only mRNA is used as template, but in our experiment it appeared some stable, which probably was concerned with species. In addition, the lowly expressed DjEF2 may serve as a good endogenous reference gene for quanti?cation of genes with low expression levels. Therefore, we recommend the use of ACTB as suitable endogenous reference gene for normalization of gene expression in the planarian regeneration study. With more housekeeping genes of planarians published, more stable endogenous reference gene will be used. Djsix-1 gene was ?rst cloned and sequenced in Dugesia japonica by Mannini Linda and was found to express in both regenerating eyes and differentiated photoreceptors of intact adults by whole-mount in situ hybridization and RNAi studies showed that it was essential for maintenance of the differentiated state of photoreceptor cells [18]. In this study, the expression level of Djsix-1 gene was the highest at zero day of regeneration and then the levels in the new regeneration tissues (named blastema) were up-regulated gradually, which agreed with the formation process of planarian eyespots. The results also indicated that ACTB or DjEF2 could be better reference genes than eight during planarian regeneration. In conclusion, selecting stable endogenous reference genes is necessary and important in normalizing the gene expression level. In this study, we validated three housekeeping genes and identi?ed ACTB as the most stably expressed endogenous reference gene in the planarian regeneration study. The results suggested that ACTB could be used to normalize genes expression levels in planarian regeneration.
Acknowledgments We thank Prof. Zhou Yanqing for editing this paper. This work was supported by the National Natural Science Foundation of China (nos. 30870368, 30670247, 30170119), the Outstanding Young Science Foundation of Henan Province (no. 0312001100) and the Innovation Foundation of Henan Province (no. 2005126), Doctor Subject Foundation of the Ministry of Education of China under Grant (No. 200804760003).

References
1. Walker CG, Meier S, Mitchell MD, Roche JR, Littlejohn M (2009) Evaluation of real-time PCR endogenous control genes for analysis of gene expression in bovine endometrium. BMC Mol Biol 31:100. doi:10.1186/1471-2199-10-100

2. Sun HF, Meng YP, Cui GM, Cao QF, Li J, Liang AH (2009) Selection of housekeeping genes for gene expression studies on the development of fruit bearing shoots in Chinese jujube (Ziziphus jujube Mill.). Mol Biol Rep 8:2183–2190 3. Jiang HB, Liu YH, Tang PA, Zhou AW, Wang JJ (2010) Validation of endogenous reference genes for insecticide-induced and developmental expression pro?ling of Liposcelis bostsrychophila (Psocoptera:Liposcelididae). Mol Biol Rep 33:1019–1029. doi: 10.1007/s11033-009-9803-0 4. Teste MA, Duquenne M, Francois JM, Parrou JL (2009) Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol Biol 26:99. doi:10.1186/1471-2199-10-99 5. Gonzalez-Verdejo CI, Die JV, Nadal S, Jimenez-Marin A, Moreno MT, Roman B (2008) Selection of housekeeping genes for normalization by real-time RT–PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development. Anal Biochem 8:176–181. doi:10.1016/j.ab.2008.05.003 6. Yang Y, Hou S, Cui G, Chen S, Wei J, Huang L (2010) Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza. Mol Biol Rep 196:507–513. doi:10.1007/s11033-009-9703-3 7. Etschmann B, Wilcken B, Stoevesand K, von der Schulenburg A, Sterner-Kock A (2006) Selection of reference genes for quantitative real-time PCR analysis in canine mammary tumors using the GeNorm algorithm. Vet Pathol Online 7:934 8. Kidd M, Nadler B, Mane S, Eick G, Malfertheiner M, Champaneria M, Pfragner R, Modlin I (2007) GeneChip, geNorm, and gastrointestinal tumors: novel reference genes for real-time PCR. Physiol Genomics 13:363–370. doi:10.1152/physiolgenomics. 00251.2006 9. Murthi P, Fitzpatrick E, Borg AJ, Donath S, Brennecke SP, Kalionis B (2008) GAPDH, 18S rRNA and YWHAZ are suitable endogenous reference genes for relative gene expression studies in placental tissues from human idiopathic fetal growth restriction. Placenta 17:798–801. doi:10.1016/j.placenta.2008.06.007 10. Schlotter YM, Veenhof EZ, Brinkhof B, Rutten VP, Spee B, Willemse T, Penning LC (2009) A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis. Vet Immunol Immunopathol 24:115–118. doi:10.1016/j.vetimm.2008.12.004 11. Van Zeveren A, Visser A, Hoorens P, Vercruysse J, Claerebout E, Geldhof P (2007) Evaluation of reference genes for quantitative real-time PCR in Ostertagia ostertagi by the coef?cient of variation and geNorm approach. Mol Biochem Parasitol 28:224–227. doi:10.1016/j.molbiopara.2007.03.005 12. Radoni A, Thulke S, Mackay IM, Landt O, Siegert W, Nitsche A (2004) Guideline to reference gene selection for quantitative realtime PCR. Biochem Biophys Res Commun 19:856–862. doi: S0006291X03025646 13. Revillion F, Pawlowski V, Hornez L, Peyrat JP (2000) Glyceraldehyde-3-phosphate dehydrogenase gene expression in human breast cancer. Eur J Cancer 20:1038–1042. doi:S0959-8049(00) 00051-4 14. Tricarico C, Pinzani P, Bianchi S, Paglierani M, Distante V, Pazzagli M, Bustin S, Orlando C (2002) Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies. Anal Biochem 27:293–300. doi:10.1016/S00032697(02)00311-1 15. Vila MR, Nicolas A, Morote J, de I, Meseguer A (2000) Increased glyceraldehyde-3-phosphate dehydrogenase expression in renal cell carcinoma identi?ed by RNA-based, arbitrarily primed polymerase chain reaction. Cancer 30:152–164. doi: 10.1002/1097-0142(20000701)89:1\152:AID-CNCR20[3.0. CO;2-T

123

Mol Biol Rep 16. Salo E, Abril JF, Adell T, Cebria F, Eckelt K, FernandezTaboada E, Handberg-Thorsager M, Iglesias M, Molina MD, Rodriguez-Esteban G (2009) Planarian regeneration: achievements and future directions after 20 years of research. Int J Dev Biol 21:1317–1327. doi:10.1387/ijdb.072414es 17. Cebria F, Guo T, Jopek J, Newmark P (2007) Regeneration and maintenance of the planarian midline is regulated by a slit orthologue. Dev Biol 5:394–406. doi:10.1016/j.ydbio.2007. 05.006 18. Mannini L, Rossi L, Deri P, Gremigni V, Salvetti A, Salo E, Batistoni R (2004) Djeyes absent (Djeya) controls prototypic planarian eye regeneration by cooperating with the transcription factor Djsix-1. Dev Biol 37:346–359 19. Pineda D, Gonzalez J, Callaerts P, Ikeo K, Gehring WJ, Salo E (2000) Searching for the prototypic eye genetic network: sine oculis is essential for eye regeneration in planarians. Proc Natl Acad Sci U S A 97(9):4525–4529 20. Mannini L, Rossi L, Deri P, Gremigni V, Salvetti A, Salo E, Batistoni R (2004) Djeyes absent (Djeya) controls prototypic planarian eye regeneration by cooperating with the transcription factor Djsix-1. Dev Biol 16:346–359. doi:10.1016/j.ydbio.2004. 01.042 21. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of realtime quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 29:34 Andersen CL, Jensen JL, Orntoft TF (2004) Normalization of real-time quantitative reverse transcription-PCR data: a modelbased variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 3:5245–5250. doi:10.1158/0008-5472.CAN-04-0496 Jian B, Liu B, Bi Y, Hou W, Wu C, Han T (2008) Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Mol Biol 10:59. doi:10.1186/ 1471-2199-9-59 Foldager CB, Munir S, Ulrik-Vinther M, Soballe K, Bunger C, Lind M (2009) Validation of suitable house keeping genes for hypoxia-cultured human chondrocytes. BMC Mol Biol 33:94. doi:10.1186/1471-2199-10-94 Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB, Wergeland HI (2006) Expression pro?ling and validation of reference gene candidates in immune relevant tissues and cells from Atlantic salmon (Salmo salar L.). Mol Immunol 9:1194–1201. doi:10.1016/j.molimm.2005.07.009 Pombo-Suarez M, Calaza M, Gomez-Reino JJ, Gonzalez A (2008) Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage. BMC Mol Biol 32:17. doi:10.1186/1471-2199-9-17

22.

23.

24.

25.

26.

123




友情链接: